PARTIE 3 : EVOLUTION DES ESPECES admin9815 6 février 2021 (0) (111)
PARTIE 3 : EVOLUTION DES ESPECES

I. BRÈVE HISTOIRE DE LA THÉORIE DE L’ÉVOLUTION

Différents modèles de la Théorie de l’Evolution ont vu le jour au cours de l’Histoire, chacun s’adaptant aux découvertes scientifiques de son époque. Voici dans les grandes lignes les principaux modèles de cette théorie :

1 – Le transformisme :

De Jean-Baptiste Lamarck (1744 – 1829) : Botaniste puis zoologue, il fait partie des pionniers sur lesquelles s’est appuyé Darwin dans le cadre de ses travaux. L’apparition des espèces se faisait selon lui par évolution naturelle. Sa théorie transformiste était fondée sur deux principes : Le premier affirmait que la complexification des êtres vivants était due à leur métabolisme. Le second justifiait la diversification et la spécialisation des espèces suite à une adaptation de leurs organes au milieu. Selon Lamarck donc, il y avait une certaine hérédité des caractères acquis. Par exemple, il expliquait que le long cou des girafes était dû au fait qu’elles essayaient d’atteindre les hautes branches pour se nourrir, et que de génération en génération leur cou s’allongeait de plus en plus du fait du caractère acquis transmis aux nouveaux nés.

Le transformisme fût abandonné au XXème siècle lorsque l’on démontra, d’une part que les espèces ne se complexifient pas en raison de leur métabolisme, et d’autre part qu’un caractère acquis par une espèce n’est pas héréditaire et ne se transmet donc pas aux générations suivantes.

2 – Le darwinisme :

De Charles Darwin (1809 -1882) : Il est connu pour être le fondateur de la Théorie de l’Evolution, avec son ouvrage intitulé, De l’Origine des Espèces, publié en 1859. Suite à de nombreux voyages à travers le monde, il utilisa ses observations des animaux et végétaux pour tenter d’expliquer la diversité des espèces. Sa théorie évolutionniste venait apporter un concept supplémentaire : « la sélection naturelle ». Ce concept stipule que seules les espèces les plus fortes et/ou les mieux adaptées à leur environnement survivront. Ainsi, la sélection naturelle était selon lui le moteur principal justifiant l’évolution ainsi que la complexification des espèces.

Seulement, les énormes avancées technologiques du XXème siècle ont permis de mieux comprendre et décrire le fonctionnement d’une cellule vivante. Contrairement aux idées qui régnaient jusqu’alors, la cellule n’est pas juste une molécule constituée de simples briques élémentaires assemblées les unes aux autres, mais plutôt comparable à une ville d’une dizaine de kilomètres carrés en activité permanente. La découverte de l’ADN permis également de mieux saisir qu’est-ce que le patrimoine génétique, son fonctionnement, les mécanismes de transmission de l’information, les conséquences sur le phénotype, sur l’apparence et les caractéristiques de l’espèce, etc…

L’idée de Darwin selon laquelle l’évolution des espèces se faisait essentiellement par sélection naturelle fût partiellement abandonnée pour laisser place à un concept « moderne » et plus en phase avec les découvertes scientifiques d’aujourd’hui, la Théorie Synthétique de l’Evolution (TSE).

3 – THÉORIE SYNTHÉTIQUE DE L’ÉVOLUTION (TSE)

Elle est une synthèse des diverses théories présentes jusqu’alors. La Théorie Synthétique de l’Evolution est la plus répandue aujourd’hui et constitue la base de travail des évolutionnistes. Aussi appelée néodarwinisme, cette théorie est basée sur la sélection naturelle des différentes mutations génétiques survenues dans le génome. Formulons explicitement cette théorie et essayons de bien en comprendre le fondement :

« L’évolution s’est faite grâce à la sélection naturelle des différentes mutations génétiques survenues dans le génome. »

Le génome : L’ADN est une succession de nucléotides. Certains morceaux d’ADN sont codants, on les appelle les gènes. D’autres séquences en revanche sont non codantes. Le génome est défini comme la totalité de cette succession de nucléotides : Il se constitue donc des séquences codantes et non codantes et correspond à l’ensemble du matériel génétique contenu dans l’ADN.

Ex :   ATGTGAAACCAGATACACATT……..TCCT → Génome
→ gène = séquences codantes            
→ Séquences non codantes
→ Génome = séquences codantes (gènes) + séquences non codantes = totalité du matériel génétique.

Une mutation génétique : C’est une modification de l’information génétique contenue dans le génome. Selon la partie du génome touchée, les conséquences d’une mutation peuvent varier : Soit le phénotype (= ensemble des traits observable d’un organisme) de l’espèce sera impacté soit il ne le sera pas. Certaines mutations sont héréditaires, c’est-à-dire que la séquence génétique mutée sera transmise à la génération suivante. D’autres en revanche ne le sont pas et auront un impact uniquement sur l’espèce en question.

En plus d’être le plus souvent muettes ou défavorables, les mutations génétiques restent un phénomène assez rare. A titre d’exemple, l’être humain possède environ 6,4 milliards de nucléotides, et en moyenne un enfant naît avec 70 mutations génétiques en comparaison à l’ADN de ses parents. Ce qui nous fait un nombre de modifications extrêmement faible.

L’évolution des espèces selon la TSE peut être résumée ainsi :
→ Des mutations génétiques ont lieu dans l’ADN d’une espèce.
→ Puis, fonction de la mutation, 3 cas de figure possibles :
→ Si cette mutation est défavorable, l’espèce sera désavantagée et ne survivra pas du fait de la pression de sélection qu’exerce l’environnement sur elle. Ce genre de mutation ne permettra pas l’évolution de cette espèce.
→ Si cette mutation est muette, il n’y aura pas d’impact sur l’espèce et celle-ci ne sera à l’origine d’aucune évolution.
→ Si cette mutation est favorable, l’espèce sera avantagée et survivra plus facilement à la pression de sélection. Si de plus cette mutation est héréditaire, alors les modifications du phénotype (s’il y en a) seront transmises aux générations suivantes.
→ L’évolution des espèces s’est faite graduellement, c’est-à-dire au fur et à mesure du temps.
→ Cette évolution graduelle est de 2 types possibles :
→ Soit de type anagenèse : Une nouvelle lignée remplace une ancienne
→ Soit de type cladogenèse : Deux nouvelles lignées se scindent à partir d’une ligne ancestrale.

Née courant du XVIIIème siècle, la Théorie de l’Evolution s’est vue peu à peu à travers l’histoire, être modelée, façonnée, adaptée aux découvertes scientifiques et avancées technologiques, jusqu’à atteindre sa dernière forme, appelée Théorie Systémique de l’Évolution (TSE) ou Néodarwinisme. Ce concept permettrai d’expliquer la diversité des formes de vie rencontrées dans la nature, en partant du principe que chaque espèce vivante se transforme progressivement au cours des générations, tant sur un plan morphologique que génétique. Cette évolution pouvant amener à l’apparition de nouvelles espèces.

Il est scientifiquement prouvé que la vie provient uniquement de la vie. En d’autres termes, la matière inerte ne peut donner la vie. Comme détaillé dans la partie 2 (Origine de la vie), cet argument scientifique des plus solides, invalide à lui seul la Théorie Synthétique de l’Evolution. Mais arrêtons-nous quand même sur d’autres arguments réfutent davantage cette théorie.

III. CONCLUSION

Après avoir subi plusieurs réajustements à travers l'Histoire, la dernière version de la Théorie Synthétique de l'Evolution (TSE) nous laisse entendre que l'évolution...
Lire la suite
6 février 2021

II. ARGUMENTS CONTRE LA TSE 5/5

7 – La reproduction sexuée : La reproduction est un processus biologique permettant la production de nouveaux organismes d'une espèce à partir d'individus préexistants de cette espèce....
Lire la suite
6 février 2021

II. ARGUMENTS CONTRE LA TSE 4/5

6 – Les Équilibres Ponctués : Selon la Théorie Synthétique de l'Evolution, l'évolution des espèces s'est faite de façon graduelle, de deux manières possibles :→...
Lire la suite
6 février 2021

II. ARGUMENTS CONTRE LA TSE 3/5

5 – L'archive fossile : Charles Darwin faisait remarquer : « Si ma théorie est vraie, un nombre illimité de variétés, qui serait le point commun...
Lire la suite
6 février 2021

II. ARGUMENTS CONTRE LA TSE 2/5

2 – La Phalène du bouleau : Un des exemples les plus répandus chez les évolutionnistes est celui du papillon dénommé la phalène du...
Lire la suite
6 février 2021

II. ARGUMENTS CONTRE LA TSE 1/5

1 – Les mutations génétiques ne créent pas de gênes : Le phénotype, l'apparence, les caractéristiques observables d'une espèce sont codées par les gènes....
Lire la suite
6 février 2021
Télécharger le livre

Pour toute question, remarque, critique constructive, autre : lasciencemeneaallah@gmail.com

I. INTRODUCTION

admin9815 07 février 2021

Mohamed est né vers 570 après J.C, dans une ville de la péninsule arabique appelée...

II. CORAN ET SCIENCE 1/12

admin9815 07 février 2021

1 – L'Univers a un début : Comme expliqué dans la Partie 1, jusqu’au début des...

II. CORAN ET SCIENCE 2/12

admin9815 07 février 2021

3 – Théorie du Big-Bang :   Il est communément admis que l’Univers est né il...

II. CORAN ET SCIENCE 3/12

admin9815 07 février 2021

5 – Orbite de la Lune et du Soleil : En mécanique physique, une orbite est la trajectoire que dessine dans...

II. CORAN ET SCIENCE 4/12

admin9815 07 février 2021

7 – Composition de l'atmosphère terrestre :  Ce qui se situe au-dessus de notre tête...

II. CORAN ET SCIENCE 5/12

admin9815 07 février 2021

8 – Rôle de l'atmosphère : D'importantes études ont été menées ces dernières décennies pour...

II. CORAN ET SCIENCE 6/12

admin9815 07 février 2021

9 – Le ciel doté de retour : Comme expliqué plus haut, le ciel terrestre est...

II. CORAN ET SCIENCE 7/12

admin9815 07 février 2021

10 – La formation du Fer et l'importance de ce métal : Les découvertes astronomiques modernes...

II. CORAN ET SCIENCE 8/12

admin9815 07 février 2021

11 – Rôle des montagnes : Autrefois, on pensait que les montagnes étaient simplement des « bosses »...

II. CORAN ET SCIENCE 9/12

admin9815 07 février 2021

12 – L'eau c'est la vie : L’eau est un élément indispensable à la Vie, à...

II. CORAN ET SCIENCE 10/12

admin9815 07 février 2021

14 – La sexualité chez les plantes : L’existence d’une sexualité chez les plantes n’a pas...

II. CORAN ET SCIENCE 11/12

admin9815 07 février 2021

16 – Les abeilles : Dans les colonies d’abeilles, à chacune des nombreuses abeilles est assignée...

II. CORAN ET SCIENCE 12/12

admin9815 07 février 2021

17 – Le mensonge contrôlé par le lobe préfrontal du cerveau : Que se passe-t-il dans...

III. CREATION DE L’HOMME DANS LE CORAN 1/3

admin9815 07 février 2021

La reproduction humaine est un sujet sur lequel toute œuvre humaine ancienne, à partir du...

III. CREATION DE L’HOMME DANS LE CORAN 2/3

admin9815 07 février 2021

2 – La formation des os et de la chair : Un autre élément important contenu...

III. CREATION DE L’HOMME DANS LE CORAN 3/3

admin9815 07 février 2021

J’ai conscience de deux choses : → D'une part, les lacunes liées à la non-maîtrise de...

IV. CONCLUSION

admin9815 07 février 2021

Toujours dans cet état d'esprit rationnel, cohérent et logique que l'on s'impose depuis le début...